Oligo design tool for Guide-it SNP screening assays

Each SNP detection assay performed using the Guide-it Knockin Screening Kit involves the application of oligos designed to detect a specific substitution at a specified genomic locus. To simplify the oligo design process, we have developed the software tool below. Input the sequences corresponding to two alleles you wish to screen (e.g., wild-type/unedited and SNP/edited versions of your genomic target sequence), and the tool will output displacement, flap-probe, wild-type control, and SNP control oligos for your assay.

NOTE: This tool designs oligo probes for the screening of single-base substitutions only, not for insertions.

• To design oligos for the detection of multiple substitutions in the genomic target region, please refer to "Detecting multiple edits" in the user guide.
• To design oligos for the detection of targeted insertions, please refer to the Guide-it Knockin Screening Kit User Manual.

Click here for design tool user guide »

Design tool guidelines:

• Edited input sequences must include exactly one SNP.
• Both unedited and edited input sequences must be the same length.
• Input sequence lengths cannot exceed 1,000 bases.
• Input sequences should consist of at least 35 bases on either side of the SNP site. For optimal probe design, we recommend including ≥50 bases on either side.

Example:

Sequence before editing: GTCCGAGAACACCTTTATTGTGCACGTCCCCCGCAGAGCAGCCTCAGGCGTCCTGGTAGTAGTTGTTGAAGTTGATGCGCAGCAGAAAGT
Sequence after editing:   GTCCGAGAACACCTTTATTGTGCACGTCCCCCGCAGAGCAGCCTCCGGCGTCCTGGTAGTAGTTGTTGAAGTTGATGCGCAGCAGAAAGT