Enrichment of ThruPLEX libraries with Agilent SureSelect platforms is easily performed. The chart below details the reagents necessary for this SureSelectXT2 protocol. The modules marked in red are not required when integrating with ThruPLEX kits. This target enrichment protocol is compatible with ThruPLEX DNA-Seq FLEX, ThruPLEX Tag-Seq FLEX, and the ThruPLEX DNA-Seq Kit.
Integration of SureSelectXT2 with ThruPLEX kits
Additional reagents
Primers
Required
Illumina P5 and P7 primers
Blocking oligos
Required
xGen Universal Blocking Oligos (TS HT-i5 and TS HT-i7)
Agilent Herculase II Fusion DNA Polymerase
Required
Agilent Cat. # 600677, 600679 (with dNTPs)
Agilent SureSelectXT2 Reagent Kit
SureSelectXT2 Library Prep Kit, ILM
Not used
Replace with ThruPLEX DNA-Seq FLEX, ThruPLEX Tag-Seq or the ThruPLEX DNA-Seq Kit.
Contact Agilent to purchase a Reagent Kit without this component.
SureSelectXT2 Pre-capture Indexes, ILM
Not used
Indexes are included in the ThruPLEX kit
SureSelectXT2 Pre-capture Box #1
Required
SureSelectXT2 Pre-capture Box #2
Required
Materials required
Reagents
ThruPLEX DNA-Seq FLEX, ThruPLEX Tag-Seq FLEX, or a ThruPLEX DNA-Seq Kit forlibrary preparation
Refer to the "Required Reagents" section of the Agilent SureSelectXT2 Protocol
A SureSelectXT2 Capture Library (e.g. SureSelectXT2 Human All Exon V5, 16; Agilent Technologies, Cat. # 5190-6208)
NOTE: This following items may be required for the post-capture amplification step:
Herculase II Fusion DNA Polymerase with dNTPs (Agilent Technologies, Cat. # 600677 or 600679)
Illumina P5 Primer: AATGATACGGCGACCACCGA
Illumina P7 Primer: CAAGCAGAAGACGGCATACGA
Equipment
As specified in the "Required Equipment" section of the Agilent SureSelectXT2 Protocol.
NOTE: When integrating ThruPLEX kits with the SureSelectXT2 library capture system, all components of the SureSelectXT2 Reagent Kit are used except the following:
SureSelect End Repair Enzyme Mix
SureSelect End Repair Oligo Mix
SureSelect dA-Tailing Master Mix
SureSelect Ligation Master Mix
SureSelectXT2 Pre-Capture Indexes
Contact Agilent to order a SureSelectXT2 Reagent Kit without the SureSelectXT2 Library Prep Kit ILM.
Protocol
ThruPLEX Library Preparation
Prepare ThruPLEX libraries according to the kit user manual.
Perform library purification using AMPure XP beads as described in the appropriate ThruPLEX user manual.
CAUTION: For the final elution, DNA must be eluted by resuspending the beads in 30 µl of PCR grade water, not TE buffer.
ThruPLEX library capture
Resuspend xGen Universal Blocking Oligos to 1 µl per reaction (or 1 nmol/µl) in nuclease-free water.
Pool ThruPLEX libraries for hybridization by adding equal amounts of each library to obtain 1.5 µg of DNA. Depending on capture library size, equal amounts of 8 or 16 libraries are pooled. For example, the SureSelectXT2 protocol recommends pooling of 8 libraries with different indexes (187.5 ng of each) when using the Human All Exon v5 Capture Library.
In a 1.5 ml microcentrifuge tube combine:
1.5 µg pooled ThruPLEX libraries
1 µl xGen Universal Blocking Oligo - TS HT-i5
1 µl xGen Universal Blocking Oligo - TS HT-i7
Concentrate the ThruPLEX libraries/xGen Universal Blocking Oligo mixture using a vacuum concentrator held at ≤45°C to reduce the volume in the tube to <7 μl. Do not completely dry the mixture.
Bring the volume to 7 μl with nuclease-free water.
Vortex the tube vigorously for 30 sec and centrifuge to bring contents to the bottom of the tube.
Add 9 μl SureSelectXT2 Blocking Mix; pipette up and down to mix.
Transfer the contents to a 0.2-ml PCR tube or to one well of a 96-well plate.
Proceed with the SureSelectXT2 Protocol starting at Chapter 4, Step 2, #2 (“Cap the wells…”) to the end of Chapter 5, Step 3.
NOTE: This protocol was developed using the SureSelectXT2 Human All Exon v5 Capture Library and the ClearSeq DNA Kinome Panel.
Related Products
User-generated protocols
User-generated protocols are based on internal proof-of-concept experiments, customer collaborations, and published literature. In some cases, relevant results are discussed in our research news BioView blog articles. While we expect these protocols to be successful in your hands, they may not be fully reviewed or optimized. We encourage you to contact us or refer to the published literature for more information about these user-generated and -reported protocols.
If you are looking for a product-specific, fully optimized User Manual or Protocol-At-A-Glance, please visit the product's product page, open the item's product details row in the price table, and click Documents. More detailed instructions for locating documents are available on our website FAQs page.
Questions? Protocols of your own that you would like to share?