User-generated protocol
Gene editing of CD3+ Pan T cells
Overview
Materials
| Product | Company | Catalog number |
|---|---|---|
| Editing reagents | ||
| Guide-it sgRNA In Vitro Transcription Kit | Takara Bio | 632635 |
| Guide-it sgRNA Screening Kit | Takara Bio | 632639 |
| Guide-it Recombinant Cas9 (Electroporation-Ready) | Takara Bio | 632641 |
| Guide-it Long ssDNA Production System | Takara Bio | 632644 |
| Neon Transfection System | Thermo Fisher Scientific | MPK5000 |
| Neon Transfection System 10 µL Kit | Thermo Fisher Scientific | MPK1096 |
| Cell culture | ||
| Peripheral blood, CD3+ Pan T Cells, negatively selected | AllCells | PB009-1F |
| Corning Falcon Polystyrene Microplate 6 well | Corning | 351146 |
| Corning Falcon Polystyrene Microplate 48 well | Corning | 351178 |
| RPMI media | Millipore Sigma | R0883-100ML |
| FBS (Tet System Approved FBS) 50 ml | Takara Bio | 631107 |
| L-glutamine | Millipore Sigma | G7513 |
| Immunocult Human CD3/CD28/CD2 T cell activator | StemCell | 10970 |
Protocol
Electroporation of CD3+ Pan T cells with the Neon Transfection System
A. Cell thawing and activation
- Warm RPMI medium containing 10% FBS.
- Quickly thaw the vial of frozen cells in a 37°C bead bath. Wipe the outside of the vial with 70% ethanol.
- Transfer cell suspension to a 50-ml conical tube.
- Rinse the cells with 1 ml of RPMI medium (with 10% FBS). Add the medium dropwise to the cells while gently swirling the conical tube.
- Slowly add medium dropwise to the cells until the total volume is 5 ml, while gently swirling after each addition of several drops of the medium.
- Slowly bring the volume up to 15 ml by adding 1–2 ml aliquots of RPMI medium (with 10% FBS) dropwise, while gently swirling after each addition.
- Centrifuge the cell suspension at 200g for 15 min at room temperature.
- Carefully remove all but 1 ml of the medium by pipetting so the cell pellet is not disturbed. Gently resuspend the cell pellet in the remaining medium.
- Slowly bring the volume up to 15 ml by adding no more than 1–2 ml of medium at once and gently swirling the tube after each addition.
- Centrifuge the cell suspension at 200g for 15 min at room temperature.
- Carefully remove all but 2 ml of the medium by pipetting. Gently resuspend the cell pellet in the remaining 2 ml of medium and count the cells by your preferred method.
- Culture the cells at a density of 1 x 106 cells/ml in a humidified incubator at 37°C with 5% CO2 for 24 hr.
- After the 24-hr incubation, activate the CD3+ T cells by adding 25 µl of ImmunoCult Human CD3/CD28/CD2 T Cell Activator per ml of cell suspension (following manufacturer's recommendation).
- Incubate cells at 37°C and 5% CO2 for up to 48–72 hrs before editing.
B. Preparation of cells and cell-culture medium
- After a minimum of 48 hrs of activation, prepare a sufficient quantity of fresh cells for your experiment.
NOTE: Each electroporation requires 2 x 105 cells. However, due to the potential variation of the pipette and tip volumes, we recommend preparing 1.5X the necessary volume of cell suspension (i.e., 3 x 105 cells) for electroporation with a 10-µl Neon Tip to ensure that there is sufficient volume. In other words, prepare a 15-µl volume of cells, RNP complex and HDR template for use with a 10-µl tip.
- Take an aliquot of the activated CD3+ T cell suspension and measure the cell density using your preferred method.
- Harvest the cells by centrifugation at 200g for 15 min in a 15-ml conical tube at 4°C. You can keep the supernatant medium for further use to recover the cells after electroporation (Section D.11).
- Wash the cells once with PBS (without Ca2+ and Mg2+) and then resuspend CD3+ T cells in Resuspension Buffer T (included with Neon kits) at a final concentration of 4 x 104 cells/µl (i.e., 3 x 105 cells in 7.5 µl total volume).
- Keep the cell suspension on ice until use.
NOTE: Minimize the time that T cells are resuspended in Resuspension Buffer T.
- Prepare enough fresh medium for culturing the cells after electroporation. You will need 0.125 ml of RPMI medium with 10% FBS for each electroporation reaction.
- Aliquot 0.125 ml of the medium prepared in Step 6 into each well of a 48-well plate. Incubate at 37°C and 5% CO2.
C. Preparation of Cas9-sgRNA RNP complex
- Thaw Guide-it Recombinant Cas9 (Electroporation-Ready) (Cat. # 632641) and sgRNA solutions at room temperature. In our test case (described below), the sgRNAs were prepared using the Guide-it In Vitro Transcription Kit (Cat. # 632635) and their activities were tested in vitro using the Guide-it sgRNA Screening Kit (Cat. # 632639). Please note that Cat. #s 632635 and 632639 are provided together as the Guide-it Complete sgRNA Screening System (Cat. # 632636).
NOTE: To avoid repeated freeze/thaw cycles, prepare aliquots upon initial thawing of Guide-it Recombinant Cas9 (Electroporation-Ready).
- Combine the following components in a 200-µl PCR tube to mix the Cas9 protein and sgRNA at a 5:1 mass ratio. The molar ratio of Cas9 protein to sgRNA will be approximately 1:1 in this mixture and the total volume will be 7.5 µl. Be sure to use the same buffer that was used to resuspend the cells (Resuspension Buffer T).
NOTE: The reaction volume indicated below is 1.5X the required volume.
Per reaction:
sgRNA (e.g., 700 ng/µl) (or 10.5 pmols) 0.49 μl* Guide-it Recombinant Cas9 (3 µg/µl) (or 10.5 pmols) 0.56 μl Resuspension Buffer T 6.45 μl* Total volume 7.5 μl* *The added volume of sgRNA will vary depending on sgRNA concentration, and the added volume of Resuspension Buffer T should be adjusted such that the total reaction volume is 7.5 µl. The volumes indicated above are based on a sgRNA concentration of 700 ng/µl.
NOTES:
-
If you are performing multiple electroporations, make a master mix and aliquot 7.5 µl per reaction into each PCR tube.
-
To maximize electroporation efficiency, the combined volume of the Cas9 and sgRNA solutions should be ≤20% of the total volume of the Cas9-sgRNA RNP complex reaction mix (e.g., for the 7.5-µl reaction specified above, the combined volume of the sgRNA and Cas9 solutions should be ≤1.5 µl).
-
For knockin experiments, the HDR donor template should be added just before mixing the Cas9-sgRNA RNP complexes with the cell suspension (Section D.3). Adjust the volume of Resuspension Buffer T included in the reaction such that the final volume upon addition of donor DNA is 7.5 µl. To generate the application data presented below, donor DNA was added in varying amounts between 0.5–1 μg.
-
- Mix the reaction well by gently pipetting up and down. Incubate using a thermal cycler preheated to 37°C with the following program:
37°C 5 min 4°C Hold
D. Electroporation
- Fill the Neon Tube with 3 ml of Buffer E (included with Neon kits) and insert the Neon Tube into the Neon Pipette Station.
- Using the touchscreen on the Neon system, set up the electroporation parameters as follows:
Pulse voltage = 1,600 V
Pulse width = 10 ms
Pulse number = 3 pulses - If performing a knockin experiment, add the HDR template to the Cas9-sgRNA RNP complex (Step C.3).
- Gently resuspend the cells by tapping and transfer 7.5 µl of the cell suspension into the PCR tube containing the 7.5 µl of Cas9-sgRNA RNP complex solution.
- Mix well by gently pipetting up and down.
- Insert the Neon Pipette into the Neon Tip and confirm that the pipette and tip are tightly connected.
- Using the Neon Pipette, aspirate the mixture of RNP and cells slowly into the Neon Tip.
NOTE: Avoid any air bubbles in the tip. If you notice air bubbles, place the sample back into the PCR tube and aspirate again into the tip without any bubbles. The presence of air bubbles causes arcing during electroporation, leading to lowered or failed transfection.
- Insert the Neon Pipette into the Neon Tube placed in the Neon Pipette Station and run the program detailed in Step 2, above.
- Remove the pipette very carefully and transfer the cells into the plate prepared in Section B.7.
- Shake the plate appropriately to disperse the cells and incubate in a humidified incubator at 37°C with 5% CO2.
- Two hours after electroporation, add 0.125 ml/well of the supernatant medium obtained in Section B.3.
NOTE: IL-2 and other activators can be used in fresh media instead (Oh, Seki & Rutz, 2019).
- Incubate at 37°C and 5% CO2.
- Perform analysis of knockout or knockin efficiency 48 hr after electroporation using your desired method.
Test case
The fusion of AcGFP to endogenous genes TUBA1A and SEC61B
As a test case, we edited CD3+ T cells in two independent experiments to fuse a fluorescent protein (AcGFP1) to two endogenous genes: TUBA1A or SEC61B. The HDR editing efficiency was determined by flow cytometry using the percentage of positive AcGFP cells four days after electroporation.
| Sequence 5'→3' | |
| sgRNA TUBA1A | GATGCACTCACGCTGCGGGAAGG |
| sgRNA SEC61B | GCCATACCATATTGGAGATGAGG |
| Stock concentration | Volume | |
| Cas9 protein | 3 mg/ml | 0.56 µl |
| sgRNA | 700 ng/µl | 0.49 µl |
| HDR template | 1 µg/µl | X µl |
| Buffer T | N/A | 7.5–X µl |
| CD3+ T cells | 4 x 104 cells/µl | 7.5 µl |
Figure 1. Details of the HDR editing experiment for the fusion of AcGFP1 with two endogenous genes, TUBA1A and SEC61B, in CD3+ T cells. Panel A. Scheme of the overall editing experiment. CD3+ T cells were electroporated with RNP complex together with an HDR template to introduce a specific sequence (encoding for fluorescent protein AcGFP1) in the desired target site (TUBA1A or SEC61B). Panel B. Sequences of the sgRNAs used in this study (PAM sequences depicted in bold). Panel C. Amounts of editing reagents and CD3+ T cells used for both electroporation reactions.
Figure 2. Optimization of HDR editing experiment and flow-cytometry analysis of edited cell population. Panel A. Percentages of AcGFP+ cells obtained in the different editing experiments designed to fuse AcGFP with TUBA1A and SEC61B genes. Different types of HDR templates (single-stranded or double-stranded DNA) as well as different amounts (from 0.5 μg to 1 μg) were tested with both genes. Panel B. (Left) Flow cytometry analysis of AcGFP1 knockin efficiencies at TUBA1A and SEC61B loci in CD3+ T cells. Following electroporation and culturing, the bulk-edited cell population and the nonelectroporated negative control cells were analyzed for AcGFP1 expression by flow cytometry. Knockin efficiencies were determined by measuring the percentage of fluorescent cells in each population (orange gates in the flow cytometry plots). (Right) Microscopy of edited cells. In each case, AcGFP1 localized in a manner consistent with the function of the endogenous protein: microtubules (TUBA1A locus) or endosomal compartments (SEC61B locus), respectively.
References
Oh, S.A., Seki, A., & Rutz, S. (2019). Ribonucleoprotein transfection for CRISRP/Cas9-mediated gene knock out in primary T cells. Curr. Protoc. Immunol., 124, e69. Doi:10.1002/cpim.69.
Related Products
User-generated protocols
User-generated protocols are based on internal proof-of-concept experiments, customer collaborations, and published literature. In some cases, relevant results are discussed in our research news BioView blog articles. While we expect these protocols to be successful in your hands, they may not be fully reviewed or optimized. We encourage you to contact us or refer to the published literature for more information about these user-generated and -reported protocols.
If you are looking for a product-specific, fully optimized User Manual or Protocol-At-A-Glance, please visit the product's product page, open the item's product details row in the price table, and click Documents. More detailed instructions for locating documents are available on our website FAQs page.
Questions? Protocols of your own that you would like to share?
Contact technical support Give feedbackTakara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2025 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.
