User-generated protocol
Gene editing of CD34+ hematopoietic stem cells
Overview
Materials
| Product | Company | Catalog number |
|---|---|---|
| Editing reagents | ||
| Guide-it sgRNA In Vitro Transcription Kit | Takara Bio | 632635 |
| Guide-it sgRNA Screening Kit | Takara Bio | 632639 |
| Guide-it Recombinant Cas9 (Electroporation-Ready) | Takara Bio | 632641 |
| Guide-it Long ssDNA Production System | Takara Bio | 632644 |
| Neon Transfection System | Thermo Fisher Scientific | MPK5000 |
| Neon Transfection System 10 µL Kit | Thermo Fisher Scientific | MPK1096 |
| Cell culture | ||
| Frozen Mobilized Peripheral CD34+ Cells | AllCells | mPB015F |
| Corning Falcon Polystyrene Microplate 6 well | Corning | 351146 |
| Corning Falcon Polystyrene Microplate 24 well | Corning | 351147 |
| HPGM Hematopoietic Growth Medium (500 ml) | Lonza | PT-3926 |
| FBS (Tet System Approved FBS) 50 ml | Takara Bio | 631107 |
| StemSpan SFEM medium | STEMCELL | 09600 |
| StemSpan CD34 Expansion Supplement (10X) | STEMCELL | 02691 |
| CD34 antibody (Clone 8G12) | BD | 340668 |
Protocol
Electroporation of CD34+ hematopoietic stem cells (HSCs) with the Neon Transfection System
A. Thawing of frozen CD34+ HSCs
- Prepare and warm HPGM medium containing 10% FBS.
NOTE: Other media can also be used in this step like DMEM, or RPMI (all containing 10% FBS).
- Thaw StemSpan SFEM medium and StemSpan CD34 Expansion Supplement at room temperature and prepare a 9:1 mix [e.g., 18 ml of StemSpan SFEM medium and 2 ml of StemSpan CD34 Expansion Supplement (10X)].
- Quickly thaw the vial of frozen cells in a 37°C bead bath. Wipe the outside of the vial with 70% ethanol.
- Transfer the cell suspension to a 50-ml conical tube.
- Rinse the cells with 1 ml of HPGM (with 10% FBS) (prepared in Step 1). Add the rinse dropwise to the cells while gently swirling the tube.
- Slowly add medium dropwise to the cells until the total volume is 5 ml, gently swirling after each addition of several drops of the medium.
- Slowly bring the volume up to 15 ml by adding 1 to 2 ml of HPGM (with 10% FBS) dropwise, while gently swirling after each addition of medium.
- Centrifuge the cell suspension at 200g for 15 min at room temperature.
- Carefully remove all but 1 ml of the medium by pipetting so the cell pellet is not disturbed. Gently resuspend the cell pellet in the remaining medium.
- Slowly bring the volume up to 15 ml by adding 1 to 2 ml of the StemSpan SFEM medium + StemSpan CD34 Expansion Supplement prepared in Step 2.
- Centrifuge the cell suspension at 200g for 15 min at room temperature.
- Carefully remove all but 2 ml of the medium by pipetting. Gently resuspend the cell pellet in the remaining 2 ml of medium and count the cells using your preferred method.
- Culture the cells at a density of 0.5 x 106 cells/ml in a 37°C humidified incubator with 5% CO2 for 48 hr.
B. Preparation of cells and media
- Prepare enough medium for culturing the cells after electroporation. You will need 0.5 ml of medium for each electroporation reaction. Thaw the media at RT and prepare a 9:1 mix [e.g., 9 ml of StemSpan SFEM medium and 1 ml of StemSpan CD34 Expansion Supplement (10X)]. Aliquot 0.5 ml/well of this medium into a 24-well plate. Keep the plate at 37°C in a humidified incubator with 5% CO2.
- Prepare a sufficient quantity of fresh cells for your experiment. Take an aliquot of the CD34+ cell suspension and measure the cell density using your preferred method.
NOTE: Each electroporation requires 1 x 105 cells. However, due to the potential variation of the pipette and tip volumes, we recommend preparing 1.5X the necessary volume of cell suspension (i.e., 1.5 x 105 cells) for electroporation with a 10-µl Neon Tip to ensure that there is sufficient volume. In other words, prepare a 15-µl volume of cells, RNP complex, and HDR template for use with a 10-µl tip.
- Harvest the cells in a 15-ml conical tube by centrifugation at 200g for 15 min at 4°C.
- Wash the cells once with PBS (without Ca2+ and Mg2+), and then resuspend the CD34+ HSCs in Resuspension Buffer T (included with Neon kits) at a final concentration of 2 x 104 cells/µl (i.e., 1.5 x 105 cells in 7.5 µl).
- Keep the cell suspension on ice until use.
NOTE: Minimize the time that the cells are resuspended in Resuspension Buffer T.
C. Preparation of Cas9-sgRNA RNP complex
- Thaw the Guide-it Recombinant Cas9 (Electroporation-Ready) (Cat. # 632641) and sgRNA solutions at room temperature. In our test case (described below), the sgRNA was prepared using the Guide-it In Vitro Transcription Kit (Cat. # 632635) and its activity was tested in vitro using the Guide-it sgRNA Screening Kit (Cat. # 632639). Please note that Cat. #s 632635 and 632639 are provided together as the Guide-it Complete sgRNA Screening System (Cat. # 632636).
NOTE: To avoid repeated freeze/thaw cycles, prepare aliquots upon initial thawing of Guide-it Recombinant Cas9 (Electroporation-Ready).
- Combine the following components in a 200-µl PCR tube to mix the Cas9 protein and sgRNA at a 5:1 mass ratio. The molar ratio of Cas9 protein to sgRNA will be approximately 1:1 in this mixture and the total volume will be 7.5 µl. Be sure to use the same buffer that was used to resuspend the cells (Resuspension Buffer T).
NOTE: The reaction volume indicated below is 1.5X the required volume.
Per reaction:
sgRNA (e.g., 1 µg/µl) (or 14 pmols) 0.45 μl* Guide-it Recombinant Cas9 (Electroporation-Ready) (3 µg/µl) (or 14 pmols) 0.75 μl Resuspension Buffer T 6.3 μl* Total volume 7.5 μl* *The added volume of sgRNA will vary depending on sgRNA concentration, and the added volume of Resuspension Buffer T should be adjusted such that the total reaction volume is 7.5 µl. The volumes indicated above are based on an sgRNA concentration of 1 µg/µl.
NOTES:
-
If you are performing multiple electroporations, make a master mix and aliquot 7.5 µl per reaction into each PCR tube.
-
To maximize electroporation efficiency, the combined volume of the Cas9 and sgRNA solutions should be ≤20% of the total volume of the Cas9-sgRNA RNP complex reaction (e.g., for the 7.5-µl reaction specified above, the combined volume of the sgRNA and Cas9 solutions should be ≤1.5 µl).
-
For knockin experiments, the HDR donor template should be added just before mixing the Cas9-sgRNA RNP complexes with the cell suspension (Section D.3). Adjust the volume of Resuspension Buffer T included in the reaction such that the final volume upon addition of donor DNA is 7.5 µl. To generate the application data presented below, 1.5 µg of the HDR template was added per reaction.
-
- Mix the reaction well by gently pipetting up and down. Incubate using a thermal cycler preheated to 37°C and run the following program:
37°C 5 min 4°C Hold
D. Electroporation
- Fill the Neon Tube with 3 ml of Buffer E (included with Neon kits) and insert the Neon Tube into the Neon Pipette Station.
- Using the touchscreen on the Neon system, set up the electroporation parameters as follows:
Pulse voltage = 1100 V
Pulse width = 20 ms
Pulse number = 2 pulses - If performing a knockin experiment, add the HDR template to the Cas9-sgRNA RNP complex prepared in Step C.3.
- Gently resuspend the cells by tapping and transfer 7.5 µl of the cell suspension into the PCR tube containing the 7.5 µl of Cas9-sgRNA RNP complex solution.
- Mix well by gently pipetting up and down.
- Insert the Neon Pipette into the Neon Tip and confirm that the pipette and tip are tightly connected.
- Using the Neon Pipette, aspirate the mixture slowly into the Neon Tip.
NOTE: Avoid any air bubbles in the tip. If you notice air bubbles, place the sample back into the PCR tube and aspirate again into the tip without any bubbles. The presence of air bubbles causes arcing during electroporation, leading to lowered or failed transfection.
- Insert the Neon Pipette into the Neon Tube placed in the Neon Pipette Station and run the program detailed in Step 2, above.
- Remove the pipette very carefully and transfer the cells into pre-warmed medium. Use the 24-well plates with 0.5 ml of medium in each well prepared in Section B.1.
- Shake the plate appropriately to disperse the cells and incubate in a humidified incubator at 37°C with 5% CO2.
- Perform analysis of knockout or knockin efficiency 48 hr after electroporation using your desired method.
E. Detection of CD34 in bulk-edited cells
Five days after editing, the presence of CD34 on the cell surface of the bulk-edited population can be checked by flow cytometry.
- Pellet 5 x105 cells by centrifugation at 300g for 5 min. Aspirate off supernatant.
- Rinse twice with cold PBS (without Ca2+ and Mg2+).
- After the last wash, resuspend the cell pellet in 80 µl of PBS (without Ca2+ and Mg2+).
- Add 20 µl of FITC Mouse Anti-Human CD34 antibody.
- Pipette gently to mix.
- Incubate on ice for 30 min protected from light.
- Centrifuge at 300g for 5 min. Aspirate off supernatant.
- Wash cells once with 1 ml of PBS (without Ca2+ and Mg2+).
- Resuspend the cell pellet in 500 µl of PBS (without Ca2+ and Mg2+). Add live/dead dye if desired.
- Analyze cells by flow cytometry.
Test case
CXCR4 editing in CD34+ HSC cells
As a test case, we edited the CXCR4 gene in CD34+ HSCs (CXCR4 encodes a co-receptor for HIV entry). As a proof of concept, we introduced two restriction sites (HindIII and BamHI) using Cas9-sgRNA RNPs in tandem with a short ssDNA oligo (ssODN) (<200 nt) as an HDR template following the above-mentioned protocol. The HDR editing efficiency was determined by Restriction Fragment Length Polymorphism (RFLP); in other words, via digestion by HindIII or BamHI, which specifically cleaved the newly integrated sequences. The editing efficiency was calculated as the ratio of DNA product to DNA substrate. After the editing experiment, the bulk-edited cells were analyzed by flow cytometry to detect the presence of CD34, indicating the capacity of the cells to reconstitute all the lineages of the immune system.
| Sequence 5'→3' | |
| sgRNA | GAAGCGTGATGACAAAGAGGAGG |
| HDR template (ssDNA oligo) | GGGCAATGGATTGGTCATCCTGGTCATGGGTTACCAGAAGAAACTGAGAAGCATGACGGACAAGTAC AGGCTGCACCTGTCAGTGGCCGAAAGCTTGGATCCCATCACGCTTCCCTTCTGGGCAGTTGATGCCG TGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGT |
| Stock concentration | Volume | |
| Cas9 protein | 3 mg/ml | 0.75 µl |
| sgRNA | 760 ng/µl | 0.59 µl |
| HDR template | 1 µg/µl | 1 µl |
| Buffer T | N/A | 5.16 µl |
| CD34+ HSCs | 2 x 104 cells/µl | 7.5 µl |
Figure 1. Experimental design for HDR editing of the CXCR4 gene in CD34+ HSCs. Panel A. Scheme of the overall editing experiment. CD34+ HSCs were electroporated with a Cas9-sgRNA RNP complex together with an ssDNA HDR template to introduce a specific sequence in the desired target site. Panel B. Sequences of the sgRNA and ssDNA oligo HDR template used in this study. The PAM site is depicted in bold in the sgRNA sequence and the HindIII and BamHI cleavage sites are shown in the HDR template in red and purple, respectively. Panel C. Amounts of editing reagents and CD34+ HSCs used for electroporation.
Figure 2. RFLP analysis and CD34 labeling of the edited cell population. Panel A. (Left) Sequence of the CXCR4 target site (with the PAM shown in light blue) and HDR template (with HindIII and BamHI sites shown in red and purple, respectively). (Right) RFLP analysis of the bulk edited population. The percent digestion of the amplified target site by HindIII or BamHI was used to detect and quantify the percentage of HDR at the CXCR4 locus. Editing efficiencies are indicated above each positive well on the gel. The extra band in the BamHI digest of the CXCR4 gene is due to a second BamHI site, encoded in the wild-type gene and unrelated to the editing experiment. Panel B. Labeling of the cells with a FITC-CD34 antibody. Five days after editing, flow cytometry was used to confirm the expression of CD34 in the bulk population of edited cells. The percentage of CD34 positive cells was >98%, indicating the presence of CD34 at the surface of the edited cells.
References
Oh, S.A., Seki, A., and Rutz, S. (2019). Ribonucleoprotein transfection for CRISRP/Cas9-mediated gene knock out in primary T cells. Curr. Protoc. Immunol., 124, e69. Doi:10.1002/cpim.69.
Related Products
User-generated protocols
User-generated protocols are based on internal proof-of-concept experiments, customer collaborations, and published literature. In some cases, relevant results are discussed in our research news BioView blog articles. While we expect these protocols to be successful in your hands, they may not be fully reviewed or optimized. We encourage you to contact us or refer to the published literature for more information about these user-generated and -reported protocols.
If you are looking for a product-specific, fully optimized User Manual or Protocol-At-A-Glance, please visit the product's product page, open the item's product details row in the price table, and click Documents. More detailed instructions for locating documents are available on our website FAQs page.
Questions? Protocols of your own that you would like to share?
Contact technical support Give feedbackTakara Bio USA, Inc.
United States/Canada: +1.800.662.2566 • Asia Pacific: +1.650.919.7300 • Europe: +33.(0)1.3904.6880 • Japan: +81.(0)77.565.6999
FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. © 2024 Takara Bio Inc. All Rights Reserved. All trademarks are the property of Takara Bio Inc. or its affiliate(s) in the U.S. and/or other countries or their respective owners. Certain trademarks may not be registered in all jurisdictions. Additional product, intellectual property, and restricted use information is available at takarabio.com.
